URGEN Genetic Lab — GenoMe test is now available in Iraq, with a smart assistant that explains your results.
ع View results Order the test
Know yourself, deeply

Your DNA tells your story —
and we read it for you

A single test reveals your ancestry, health risks, nutritional needs, and unique traits across 14 sections — then our smart assistant «Dr. GenoMe» explains them in simple language you understand.

Order your test now I have a code — view results
Home saliva sample Full data privacy Smart assistant
Your Genomic Report14 sections · personalized analysis
Ready
Health Risks
Low
Vitamin D
Higher need
Endurance response
Excellent
Largest ancestryEthnic makeup
Middle Eastern
Dr. GenoMe answers you
14
analytical sections
700+
genetic markers
Saliva
one sample from home
Bilingual
assistant (Arabic & English)
ATGCGATTCGACGTAGCTAGCATCGGATCAGCTTACGATCGTAGCATGCATCGATTACGCATGCTAGCATCGTACGATCGATCGTAGCATGCTAGCATCGTAA  YOUR GENOMIC SEQUENCE  ATGCGATTCGACGTAGCTAGCATCGGATCAGCTTACGATCGTAGCATGCATCGATTACGCATGCTAGCATCGTACGATCGATCGTAGCATGCTAGCATCGTAA   ATGCGATTCGACGTAGCTAGCATCGGATCAGCTTACGATCGTAGCATGCATCGATTACGCATGCTAGCATCGTACGATCGATCGTAGCATGCTAGCATCGTAA  YOUR GENOMIC SEQUENCE  ATGCGATTCGACGTAGCTAGCATCGGATCAGCTTACGATCGTAGCATGCATCGATTACGCATGCTAGCATCGTACGATCGATCGTAGCATGCTAGCATCGTAA  
What is the GenoMe test?

A complete map of what makes you you

An analysis of your DNA that reads the subtle genetic variations in your body and translates them into a clear report covering your health, ancestry, nutrition, and traits — from a single saliva sample, with no needles or pain.

Precise science

We rely on genotyping technology and high-standard computational models to read the clinically relevant variants in your genome.

Comprehensive report

Your results span 14 sections: from health risks and genetic diseases to nutrition, fitness, skin, and ethnic origins.

Explained by a smart assistant

You are never left alone with complex numbers — «Dr. GenoMe» reads your report and answers your questions with examples from your life.

Discover yourself with the GenoMe test
Our philosophy

You deserve to know yourself first

When you see your features in the mirror, you see only half the story. The other half is written in your DNA: why you look the way you do, why your body behaves as it does, and what sets you apart from everyone around you. The GenoMe test reads that hidden half for you.

Understand your body at its source — from your genes, not from guesswork
Discover the traits, tendencies, and origins that shaped who you are
Make wiser health decisions grounded in knowing yourself
Start discovering yourself
Why does it matter?

Know today… prevent tomorrow

Many diseases show no symptoms until it is late. Your genes carry early signals that let you act at the right time.

How it works

Four simple steps

From ordering the test to reading your results with your smart assistant — the whole process is easy and comfortable.

Science-led knowledge

Discovery based on knowledge

Behind every result in your report are years of science and global standards of reading and analysis. At URGEN Lab we turn your complex genetic code into clear knowledge you can act on — with confidence and precision.

Order your test now Meet Dr. GenoMe
GenoMe test — discovery based on knowledge
Test sections

14 sections revealing your different sides

Each section opens a window onto a part of your body and life. Here is what you will discover in your full report.

Your smart assistant

Meet «Dr. GenoMe»

An AI assistant we built at URGEN Lab to read your genomic report and explain it in simple language — it answers your questions in Arabic or English, and gives advice tailored to your age, gender, and environment.

Natural conversationAsk it «What are my top health risks?» or «Which vitamins do I need?» and it answers from your own report.
Advice from your realityDietary suggestions using foods available in the local market that respect your values and habits.
Yours aloneEach code is tied to your personal report only, and your conversations are saved and secure.

View your results

Enter the access code the lab sent you to go straight into your conversation with Dr. GenoMe.

Don't have a code yet? Order your test here

Order the test

Begin your journey with your genome

One test kit unlocks all sections, plus full access to your smart assistant, Dr. GenoMe.

GenoMe Comprehensive Test

The full report across all fourteen sections + the Dr. GenoMe assistant

Request a quote
  • Analysis of 14 sections and 700+ genetic markers
  • Home saliva collection kit
  • Detailed digital report
  • Smart summary of your key findings
  • Full access to the «Dr. GenoMe» assistant
  • Complete privacy and confidentiality

Order form

Fill in your details and we will contact you to complete the order and arrange kit delivery.

WhatsApp will open with a ready message containing your details — just tap send.

FAQ

Everything you want to know

Your body hides many answers

Start today and discover what your DNA says about your health, ancestry, and future — with an assistant that walks with you every step.

Order your test now I have a code